guide rna (grna) sequences Search Results


92
Addgene inc guide rna
Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna/product/Addgene inc
Average 92 stars, based on 1 article reviews
guide rna - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

93
Addgene inc cdr1as sequence
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Cdr1as Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cdr1as sequence/product/Addgene inc
Average 93 stars, based on 1 article reviews
cdr1as sequence - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Broad Institute Inc lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Lentivirus Encoding A Guide Rna (Grna) For Gpr137b (Cgtgaagctcggcctcaccg), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg)/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Guide Rna (Grna) Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) sequences/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ATUM Bio guide rna (grna) design tool
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Guide Rna (Grna) Design Tool, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) design tool/product/ATUM Bio
Average 90 stars, based on 1 article reviews
guide rna (grna) design tool - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation the guide (g)rna was designed using the gencrispr grna design tool
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
The Guide (G)rna Was Designed Using The Gencrispr Grna Design Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the guide (g)rna was designed using the gencrispr grna design tool/product/GenScript corporation
Average 90 stars, based on 1 article reviews
the guide (g)rna was designed using the gencrispr grna design tool - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc pu6-guide rna (grna)
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Pu6 Guide Rna (Grna), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pu6-guide rna (grna)/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
pu6-guide rna (grna) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma guide rna (grna) of the hur gene
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Guide Rna (Grna) Of The Hur Gene, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) of the hur gene/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
guide rna (grna) of the hur gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation guide rna (grna) designing tool
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Guide Rna (Grna) Designing Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) designing tool/product/GenScript corporation
Average 90 stars, based on 1 article reviews
guide rna (grna) designing tool - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma crispr guide rna (grna
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Crispr Guide Rna (Grna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rna (grna/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
crispr guide rna (grna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc guide rna (grna) sequences targeting the exon regions of the human il15ra gene
Schematic overview of the CRISPR clone generation workflow. Guide <t>RNA</t> s ( <t>gRNA</t> s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays
Guide Rna (Grna) Sequences Targeting The Exon Regions Of The Human Il15ra Gene, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna (grna) sequences targeting the exon regions of the human il15ra gene/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
guide rna (grna) sequences targeting the exon regions of the human il15ra gene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.

Journal: Bone

Article Title: A role for G protein-coupled receptor 137b in bone remodeling in mouse and zebrafish

doi: 10.1016/j.bone.2019.06.002

Figure Lengend Snippet: (A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.

Article Snippet: Lentivirus encoding a guide RNA (gRNA) for Gpr137b (CGTGAAGCTCGGCCTCACCG) or EGFP control (GAAGTTCGAGGGCGACACCC) were generated by the Broad Institute Genetic Perturbation Platform (Cambridge, MA) using the pXPR_003 vector.

Techniques: Transduction, Modification, Western Blot, Membrane, Expressing, Control, Staining, Activity Assay, Cell Culture, MANN-WHITNEY

Schematic overview of the CRISPR clone generation workflow. Guide RNA s ( gRNA s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Schematic overview of the CRISPR clone generation workflow. Guide RNA s ( gRNA s) were designed to target exon 1 of the VWF gene (Step 1) and cloned into a Lenti CRISPR V2 vector (Step 2). HEK 293T cells were transfected with a vector containing a VWF targeting gRNA ( gRNA ‐1 or gRNA ‐2) or the empty Lenti CRISPR vector as a control ( CTRL ) (Step2). Lentivirus was produced in endothelialcell growth medium 18, and medium was transferred to cord blood outgrowth endothelial cells (cb BOEC s) from a single donor for transduction either directly or after combining medium containing 2 gRNA s, sometimes combining virus containing 2 different gRNA s for increased targeting efficiency (Step 4). Transduced cells were selected by puromycin and single‐cell sorted using vascular endothelial (VE) ‐cadherin as an endothelial cell surface marker (Step 5). Medium of single‐cell clones was collected for an ELISA‐ mediated high‐throughput screen for von Willebrand factor (VWF) deficient clones. Putative knockout clones were expanded to multiple larger culture surfaces for western blot ( WB ) and sequencing analysis to confirm biallelic VWF knockout (Step 8), after which they were cryopreserved or used for functional assays

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: CRISPR, Clone Assay, Plasmid Preparation, Transfection, Control, Produced, Transduction, Virus, Marker, Enzyme-linked Immunosorbent Assay, High Throughput Screening Assay, Knock-Out, Western Blot, Sequencing, Functional Assay

Screening and mutation analysis of VWF knockout clones. (A) Conditioned medium of single‐cell clones that had reached >50% confluence was collected, and an ELISA for (secreted) von Willebrand factor (VWF) was performed as a first screen for VWF‐ deficient clones. Arrows indicate control ( CTRL ) and gRNA targeted clones that were selected for further screening. (B) After selected clones had been expanded to 6‐well plates and reached confluence, cells were lysed and VWF deficiency was assayed using immunoblotting with polyclonal anti‐ VWF and anti‐β‐actin as a loading control. Two control clones ( CTRL A and CTRL B) and two VWF −/− clones ( VWF −/− A and VWF −/− B) were selected, as indicated by the arrows. (C) Sanger sequencing and next‐generation sequencing on exon 1 of VWF were used to identify CRISPR /Cas9‐induced mutations. Sanger sequence traces are shown for all clones, and major mutations in both VWF −/− clones are indicated in the figure

Journal: Research and Practice in Thrombosis and Haemostasis

Article Title: Alternative trafficking of Weibel‐Palade body proteins in CRISPR /Cas9‐engineered von Willebrand factor–deficient blood outgrowth endothelial cells

doi: 10.1002/rth2.12242

Figure Lengend Snippet: Screening and mutation analysis of VWF knockout clones. (A) Conditioned medium of single‐cell clones that had reached >50% confluence was collected, and an ELISA for (secreted) von Willebrand factor (VWF) was performed as a first screen for VWF‐ deficient clones. Arrows indicate control ( CTRL ) and gRNA targeted clones that were selected for further screening. (B) After selected clones had been expanded to 6‐well plates and reached confluence, cells were lysed and VWF deficiency was assayed using immunoblotting with polyclonal anti‐ VWF and anti‐β‐actin as a loading control. Two control clones ( CTRL A and CTRL B) and two VWF −/− clones ( VWF −/− A and VWF −/− B) were selected, as indicated by the arrows. (C) Sanger sequencing and next‐generation sequencing on exon 1 of VWF were used to identify CRISPR /Cas9‐induced mutations. Sanger sequence traces are shown for all clones, and major mutations in both VWF −/− clones are indicated in the figure

Article Snippet: Guide RNA (gRNA) sequences targeting the first exon of VWF were designed using the MIT CRISPR design tool ( http://crispr.mit.edu ) and the BROAD Institute single guide RNA (sgRNA) designer ( http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design ) by submitting the DNA sequence of VWF exon 1 flanked by 100 bp up‐ and downstream (chromosome 12, 6123020‐6123259 positive strand; Figure ). gRNA sequences were selected that have a high predicted efficiency (BROAD Institute score) and a high inverted off‐target score (MIT CRISPR design tool)., gRNAs used in this study were gRNA‐1: 5′‐TGGCCCTCATTTTGCCAGGT‐3′ and gRNA‐2: 5′‐AGCACCCCGGCAAATCTGGC‐3′.

Techniques: Mutagenesis, Knock-Out, Clone Assay, Enzyme-linked Immunosorbent Assay, Control, Western Blot, Sequencing, Next-Generation Sequencing, CRISPR